ABSTRACT
The
rapid and irrepressible increase in antimicrobial resistance of pathogenic
bacteria that has been observed over the last decades is widely accepted to be
one of the major problems of human medicine today. Several aspects of this
situation are especially worrying. Many resistance mechanisms that emerge and
spread in bacteria populations are those of wide activity spectra, which
compromise all or a majority of drugs belonging to a given therapeutic group.
Finally, multiple mechanisms affecting the same or different groups of
antimicrobials coexist and are even co-selected in more and more strains of
pathogenic bacteria. (Antimicrobial agents and Chemotherapy , March2012:vol.
56(3).
INTRODUCTION
Enterobacteriaceae are short gram-negative
rods,either motile or non motile,grow well on MacConkey agar, grows aerobically
or anaerobically ,ferment rather than oxidize glucose often with gas production,
are catalase positive, oxidase negative and reduce nitrate to nitrite. (Geo.F.Brooks,et.al
(2010), Jawetz, Melnick & Adelberg’s Medical Microbiology, 25th Ed. Pp 340).
One of the most
resistant mechanism is that found in Enterobacteriaceae, which reduces the
efficacy even of modem expanded – spectrum cephalosporin’s (except cephamycins
and carbapenems) and monobatams is based on plasmid mediated production of
extended spectrum beta lactamases (ESBL).
Extended spectrum
beta lactamase producing strains have been detected to increase in the general
community were studies have been published about its prevalence in healthy
humans. (Antimicrobial Agents and Chermotherapy) volume 56.3 ).
Extended
spectrum beta lactamases arises as a result of mutations in the TEM -1,TEM -2
or SHV-1 genes, commonly found in the Enterobacteriaceae family.These enzymes
are found predominantly in klebsiella species
and Escherichia coli.
They are capable of hydrolyzing penicillins,broad spectrum cephalosorins and monobactams but they do not affect the cephamycins or carbapenems and their activity is inhibited by clavulanic acid.
They are capable of hydrolyzing penicillins,broad spectrum cephalosorins and monobactams but they do not affect the cephamycins or carbapenems and their activity is inhibited by clavulanic acid.
Klebisieua pneumonia and Escherichia coli are one group of beta lactamases
(penicillin destroying enzymes) that produce the enzyme called extended spectrum
beta lactamases(ESBLs),because they confer upon bacteria the additional ability
to hydrolyze the beta lactam rings of cefotaxime,ceftazime or aztreonam.They
are normal flora of the large intestine. The most common extended spectrum beta
lactamases in three decades ago were the class A TEM and SHV plasmid mediated
types. (Geo. F. Brooks, et al; (2010). Jawetz, Melnick and Adelerg’s Medical Microbiology
(25thEd), Pp.340. McGraw Hill).
But the
emergence of K. Pnevmonia carbapenemases (KPC) which confer resistance to third
and fourth generation cephalosporins and carbapenems, led to plasmid mediated resistance
mechanism. CTX-M enzymes have become more prevalent resistant throughout the
world. (Geo. F Brooks, et al (2010). Jawetz, Melnick and Adleberg’s Medical Microbiology,
25th Ed, Pp. 340, McGraw Hill).
AIMS
AND OBJECTIVES
This is to screen for the occurrence of
Extended spectrum beta lactamase producing Enterobacterianceae in healthy
carriers in Abakaliki fast- food joints.
SAMPLE
COLLECTION
Routine samples will be collected from
healthy staff members of fast-food joints in Abakaliki Urban areas. 300 samples
(feaces) will be collected in sterile tubes. There will be no transport medium
because the samples will be processed within 24 hours of collection. Each
person will be tested once and the sample will be collected form staff without
diarrhea. Their ages should be between 20 and 60 years, mainly females.
MORPHOLOGY
AND IDENTIFICATION
Enterobacteriaceae
are short gram-negative rods, either motile with peritrichous flagella or
non-motile, grow well on McConkey agar, facultative aerobes or anaerobes), ferment
rather than oxidize glucose, often with gas production, are catalase positive,
oxidize negative and reduce nitrate. (Geo.F.Brooks,et al;(2010), Jawetz,
Melnick & Adelberg’s Medical Microbiology (25th Ed). Pp.
213-214, McGraw Hill).
E.coli
and K.pneumonia
as my major organisms of study can thus be differentiated;
E. coli forms circular convex, smooth
colonies with distinct edges, motile, indole positive, citrate negative and
voges-proskauer negative, acid fermenters and
methyl-red test (90%) where as k.
pneumonia forms large and mucoid colonies which tent to coalesce with
prolonged incubation, non-motile, indole negative, citrate and voges-proskaver
positive, butanediol fermenters and methyl-red test (10%). (Geo.F.Brooks,et al;
(2010),Jawetz,Melnick & Adelberg’s Medical Microbiology,25th Ed.
Pp. 214-215, McGraw Hill).
MEDIA
TO BE USED
Eosin-methylene blue (EMB), MacConkey or
deoxycholate medium can be use as they contain special dyes and carbohydrates
which distinguishes lactose-fermenting (coloured) from non-lactose fermenting
(non-pigmented) colonies and allows rapid presumptive identification of enteric
bacteria. Triple Sugar Iron (TSI) agar, will also be used as they help to
differentiate salmonella and Shigella spps from the samples. Serotype will be
performed according to the standard method. (Geo. F.Brooks,et.al;
(2010),Jawetz,Melnick & Adelberg’s Medical Microbiology,25th Ed.
Pp 214,McGraw Hill).
SUSCEPTIBILITY
TEST
Disk diffusion method according to
Clinical and Laboratory Standard Institute (CLSI) protocols will be performed
and evaluated according to their criteria with 15 antimicrobial agents such as
Ampillicin, cephalothin, cefuroxine, cefpodoxime, cofotaxime, ceftazidime,
cefepime, trimethroprim-sulfamethoxazole, tetracycline, ciprofloxacin
polymyxin, amoxicillin, clavulanic acid, cefoxitin, kanamycin and gentamicin.
ESBL producers will be confirmed on
muller-Hintor agar plates using E test –ESBL-strips containing cofokaxime,
cefepime or ceftazidime each alone and in combination with clavulanic acid.
BIOCHEMICAL
TESTS
Oxidase test will performed and
non-fermented samples will be discarded. Indole test, methyline red, voges
proskauer test, citrate test, motility test, manitol fermentation and hydrogen
sulfide test will be carried out to enable distinguish E.coli from K.pneumonia.
POLYMERASE
CHAIN REACTION ANALYSIS OF BETA LACTAMASES
The bacterial strains confirmed as
producing ESBLS will be further analyze by PCR and by sequencing the whole open
reading flames (ORF) of bla genes. DNA will be extracted by a standard heat
lysis protocol.
PRIMERS
Five specific published primer sets and
PCR protocols (13,30,33,38) will be used to search for B-lactmase encoding genes belonging to blaTEM, and three
blaCTX-M sub-families to ensure coverage of all entire bla ORFs.
The primer sets will be supplemented with the following primers from up and
down streams blaCTX-M flanking regions, such as;
5’AAACACACGTGGAATTTAGGG3’,5CCGTCGGTGACGATTTAGCC3’,5’CCGATGACTATGCGCACTGGG3’,5TTTGCCGTCCTGCGTACC3’,5CCGTGGGTTACGATTTTCGCC3’,5TTGGTCCAGAAAAAAGACGG3’,5’TGATGTAACACGGATTGACCG3’,5’AAACCAGTTACAGCCCTTCGG3’,5TGGAGCCACGGTTGATGAGG3’
The results will be purified using the
PCR purification kit (according to the manufacturer’s recommendations).
REFERENCES
Antimicrobial Agents and Chemotherapy,
Volume 56(3).
Emerging infections disease, April
2001;Volume,7(2).
Emerging infections disease, Feb. 2008;
Volume ,7
Geo F. Brooks, Karen C. Caroll, Janet S.
Butel, Stephen A. Morse and Timothy A. Mietzner, (2010); Jawetz, Melnick &
Adelberg’s Medical Microbiology 25th Ed, McGraw Hill).
Pathogenic Profile Dictionary, 2010.
Undergraduate of Biological Sciences,
Science Gov.Com;Science indeed,
www:science.gv/biochemical characterization bacteria.